Stem-loop sequence ptr-mir-550-1

AccessionMI0008765 (change log)
DescriptionPan troglodytes miR-550-1 stem-loop
Gene family MIPF0000334; mir-550
Stem-loop
   u  u    u c   cu   gca                  g c     gu 
5'  ga gcuu g ugg  ggu   gugccugagggaguaaga c cuguu  u
    || |||| | |||  |||   |||||||||||||||||| | |||||  g
3'  cu ugaa c acc  cua   cacggacucccucauucu g gauag  u
   -  c    - a   -u   ---                  - u     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 28838042-28838137 [-]
antisense
ENSPTRT00000054691 ; ptr-mir-550-1-201; exon 1
Database links

Mature sequence ptr-miR-550

Accession MIMAT0008230
Sequence

22 - 

agugccugagggaguaagagccc

 - 44

Get sequence
Evidence by similarity; MI0003600
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).