Stem-loop sequence ptr-mir-548p

AccessionMI0008763 (change log)
DescriptionPan troglodytes miR-548p stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548p
(2 sentences)

Stem-loop
   -    g      a     u               uc   ac 
5'  auua guuggu uaaaa uaauugcaguuuuug  auu  u
    |||| |||||| ||||| |||||||||||||||  |||   
3'  uaau uaacca guuuu auugacgucaaaaac  uaa  u
   a    g      c     c               ga   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr5: 100119979-100120061 [-]
sense
ENSPTRT00000068386 ; ptr-mir-548p-201; exon 1
ENSPTRT00000031696 ; ST8SIA4-201; intron 4
Database links

Mature sequence ptr-miR-548p

Accession MIMAT0008228
Sequence

47 - 

uagcaaaaacugcaguuacuuu

 - 68

Get sequence
Evidence by similarity; MI0006420
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).