Stem-loop sequence ptr-mir-548n

AccessionMI0008762 (change log)
DescriptionPan troglodytes miR-548n stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548n
(2 sentences)

Stem-loop
   -      a                 a      cg  a 
5'  agguug ugcaaaaguaauugugg uuuugu  uu a
    |||||| ||||||||||||||||| ||||||  ||  
3'  uccaac acguuuucauuaacgcc aaaacg  aa a
   a      c                 c      au  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
KV420936.1: 246113-246187 [+]
sense
ENSPTRT00000036207 ; DPY19L1-201; intron 18
Database links

Mature sequence ptr-miR-548n

Accession MIMAT0008227
Sequence

10 - 

caaaaguaauuguggauuuugu

 - 31

Get sequence
Evidence by similarity; MI0006399
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).