Stem-loop sequence ptr-mir-548l

AccessionMI0008761 (change log)
DescriptionPan troglodytes miR-548l stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548l
(2 sentences)

Stem-loop
   -uauua          a     u      g         aga 
5'       gguuggugca aagua uugcgg uuuugucau   a
         |||||||||| ||||| |||||| |||||||||    
3'       ccaaccacgu uucau gacguc aaaacggua   a
   cguaaa          g     u      a         aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 94539922-94540006 [-]
sense
ENSPTRT00000007806 ; MRE11A-201; intron 10
Database links

Mature sequence ptr-miR-548l

Accession MIMAT0008226
Sequence

15 - 

aaaaguauuugcggguuuuguc

 - 36

Get sequence
Evidence by similarity; MI0006361
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).