Stem-loop sequence ptr-mir-548k

AccessionMI0008760 (change log)
DescriptionPan troglodytes miR-548k stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548k
(2 sentences)

Stem-loop
   -uuuucucaa      c           u         c      a       uuac 
5'           guauug uguuagguugg gcaaaagua uugcgg uuuugcu    u
             |||||| ||||||||||| ||||||||| |||||| |||||||    u
3'           cguagu auaauccaacu cguuuuuau aacgcc aaaacgg    u
   ucgguuaaaa      -           u         u      a       uaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 70178759-70178873 [+]
sense
ENSPTRT00000068356 ; ptr-mir-548k-201; exon 1
ENSPTRT00000007465 ; PPFIA1-201; intron 2
Database links

Mature sequence ptr-miR-548k

Accession MIMAT0008225
Sequence

31 - 

aaaaguacuugcggauuuugcu

 - 52

Get sequence
Evidence by similarity; MI0006354
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).