Stem-loop sequence ptr-mir-548j

AccessionMI0008759 (change log)
DescriptionPan troglodytes miR-548j stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548j
(2 sentences)

Stem-loop
   -    agc     -aa    ua                 u     c    a    ac 
5'  gggc   cagug   uagu  gcuggugcaaaaguaau gcggu uuug uauu  u
    ||||   |||||   ||||  ||||||||||||||||| ||||| |||| ||||   
3'  cuug   gucgc   auca  cgaccacguuuucauua cguca aaac guaa  u
   a    --a     aag    uc                 -     a    g    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr22: 13088316-13088426 [-]
sense
ENSPTRT00000026526 ; TPST2-201; intron 1
Database links

Mature sequence ptr-miR-548j

Accession MIMAT0008224
Sequence

29 - 

aaaaguaauugcggucuuug

 - 48

Get sequence
Evidence by similarity; MI0006345
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).