Stem-loop sequence ptr-mir-548i-4

AccessionMI0008756 (change log)
DescriptionPan troglodytes miR-548i-4 stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548i-4
(2 sentences)

Stem-loop
   c     gc  -----         ----------caucc             -c           cg a           a 
5'  agaug  uc     cgaaguuug               uauuagguuggug  aaaaguaauug  g uuuugccauua a
    |||||  ||     |||||||||               |||||||||||||  |||||||||||  | |||||||||||  
3'  ucuac  ag     guuucaaac               augauccgaccau  uuuuuauuaac  u aaaacgguaau a
   c     ua  ucccu         cauuuccucuuuucu             uu           aa a           g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 7418189-7418336 [-]
intergenic
Database links

Mature sequence ptr-miR-548i

Accession MIMAT0008223
Sequence

39 - 

aaaaguaauugcggauuuugcc

 - 60

Get sequence
Evidence by similarity; MI0006421
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).