Stem-loop sequence ptr-mir-548i-3

AccessionMI0008755 (change log)
DescriptionPan troglodytes miR-548i-3 stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548i-3
(2 sentences)

Stem-loop
   --     g   -----         -----------cauccuc                        g a           a 
5'   agaug cuc     cgaaguuug                  uuagguuggugcaaaaguaauugc g uuuugccauua a
     ||||| |||     |||||||||                  |||||||||||||||||||||||| | |||||||||||  
3'   ucuac gag     guuucaaac                  gauccgaucauguuuuuauuaacg c aaaacgguaau a
   ac     a   ucccu         caucuuccucuuuucuau                        a a           g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 100811218-100811365 [+]
intergenic
KV420882.1: 115284-115431 [+]
intergenic
Database links

Mature sequence ptr-miR-548i

Accession MIMAT0008223
Sequence

38 - 

aaaaguaauugcggauuuugcc

 - 59

Get sequence
Evidence by similarity; MI0006421
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).