Stem-loop sequence ptr-mir-548i-2

AccessionMI0008754 (change log)
DescriptionPan troglodytes miR-548i-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548i-2
(2 sentences)

Stem-loop
   c         -----         -----------caucc                          g a       a   a 
5'  agauggcuc     cgaaguuug                uauuagguuggugcaaaaguaauugc g uuuugcc uua a
    |||||||||     |||||||||                |||||||||||||||||||||||||| | ||||||| |||  
3'  ucuaccgag     guuucaaac                augauccgaccauguuuuuauuaacg c aaaacgg aau a
   c         ucccu         caucuuccucuuuucu                          a a       c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr3: 15500930-15501077 [-]
intergenic
Database links

Mature sequence ptr-miR-548i

Accession MIMAT0008223
Sequence

39 - 

aaaaguaauugcggauuuugcc

 - 60

Get sequence
Evidence by similarity; MI0006421
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).