Stem-loop sequence ptr-mir-548h

AccessionMI0008752 (change log)
DescriptionPan troglodytes miR-548h stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548h
(2 sentences)

Stem-loop
   -----ucugucc       g              cg        gu     c 
5'             auuaggu ggugcaaaaguaau  cgguuuuu  cauua u
               ||||||| ||||||||||||||  ||||||||  |||||  
3'             uaaucca ucacguuuucauua  gucaaaaa  guaau u
   uauaccgaauua       g              ag        ug     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 48448682-48448782 [-]
antisense
ENSPTRT00000011768 ; SYNE2-201; intron 61
Database links

Mature sequence ptr-miR-548h

Accession MIMAT0008222
Sequence

21 - 

aaaaguaaucgcgguuuuuguc

 - 42

Get sequence
Evidence by similarity; MI0006411
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).