Stem-loop sequence ptr-mir-548c

AccessionMI0008749 (change log)
DescriptionPan troglodytes miR-548c stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548c
(2 sentences)

Stem-loop
   cauuggcauc                         c         cau   u 
5'           uauuagguuggugcaaaaguaauug gguuuuugc   uac u
             ||||||||||||||||||||||||| |||||||||   ||| u
3'           auaauucaaccacguuuucauuaac cuaaaaacg   aug c
   --------uc                         u         ---   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr12: 25054828-25054923 [-]
sense
ENSPTRT00000009513 ; RASSF3-201; intron 1
antisense
ENSPTRT00000054788 ; ptr-mir-548c-201; exon 1
Database links

Mature sequence ptr-miR-548c

Accession MIMAT0008220
Sequence

61 - 

caaaaaucucaauuacuuuugc

 - 82

Get sequence
Evidence by similarity; MI0003630
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).