Stem-loop sequence ptr-mir-548b

AccessionMI0008748 (change log)
DescriptionPan troglodytes miR-548b stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548b
(2 sentences)

Stem-loop
   cagacuauauau                       ca     g   uuuau 
5'             uuagguuggcgcaaaaguaauug  guuuu gcc     u
               |||||||||||||||||||||||  ||||| |||      
3'             aauccaaccguguuuucguugac  caaga cgg     u
   --------ucau                       uc     a   uaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr6: 122780874-122780969 [-]
sense
ENSPTRT00000056866 ; FAM184A-201; intron 2
Database links

Mature sequence ptr-miR-548b

Accession MIMAT0008219
Sequence

61 - 

caagaaccucaguugcuuuugu

 - 82

Get sequence
Evidence by similarity; MI0003596
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).