Stem-loop sequence ptr-mir-548a-2

AccessionMI0008747 (change log)
DescriptionPan troglodytes miR-548a-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548a-2
(2 sentences)

Stem-loop
   gugaug        guuu            c  -g     uu  c     a 
5'       uguauuag    gugcaaaaguaa ug  gguuu  ug cauua a
         ||||||||    |||||||||||| ||  |||||  || |||||  
3'       auauaauc    cacguuuucauu ac  ucaaa  ac guaau a
   -----a        aaac            a  gg     --  a     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr6: 139153767-139153862 [+]
intergenic
Database links

Mature sequence ptr-miR-548a

Accession MIMAT0008218
Sequence

60 - 

caaaacuggcaauuacuuuugc

 - 81

Get sequence
Evidence by similarity; MI0003598
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).