Stem-loop sequence ptr-mir-548a-1

AccessionMI0008746 (change log)
DescriptionPan troglodytes miR-548a-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention ptr-mir-548a-1
(2 sentences)

Stem-loop
   ----g    gagguauuaag                   g u     c a   a 
5'      cagg           uuggugcaaaaguaauugu g uuuug c uua a
        ||||           ||||||||||||||||||| | ||||| | |||  
3'      gucc           aaccacguuuucauuaacg u aaaac g aau a
   uuaua    ----------a                   g c     a c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr6: 18773503-18773598 [+]
intergenic
Database links

Mature sequence ptr-miR-548a

Accession MIMAT0008218
Sequence

60 - 

caaaacuggcaauuacuuuugc

 - 81

Get sequence
Evidence by similarity; MI0003598
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).