Stem-loop sequence ptr-mir-515-2

AccessionMI0008704 (change log)
DescriptionPan troglodytes miR-515-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

1 open access papers mention ptr-mir-515-2
(2 sentences)

Stem-loop
   -    u     c  u           a    uu      gu 
5'  cuca gcagu au cuccaaaagaa gcac  ucuguu  c
    |||| ||||| || ||||||||||| ||||  ||||||  u
3'  gagu uguca ug gagguuuucuu cgug  agacga  g
   a    u     u  c           c    --      aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56033165-56033246 [+]
sense
ENSPTRT00000060884 ; ptr-mir-515-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-515-2
ptr-mir-520echr19: 56023852-56023937 [+]
ptr-mir-515-1chr19: 56027150-56027231 [+]
ptr-mir-519echr19: 56028091-56028176 [+]
ptr-mir-520fchr19: 56030298-56030383 [+]
ptr-mir-515-2chr19: 56033165-56033246 [+]
ptr-mir-519cchr19: 56034635-56034720 [+]
ptr-mir-1283achr19: 56036646-56036731 [+]
ptr-mir-520achr19: 56039028-56039111 [+]
ptr-mir-526bchr19: 56042520-56042601 [+]
Database links

Mature sequence ptr-miR-515

Accession MIMAT0008181
Sequence

50 - 

gagugccuucuuuuggagcguu

 - 71

Get sequence
Evidence by similarity; MI0003144
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).