Stem-loop sequence ptr-mir-503

AccessionMI0008698 (change log)
DescriptionPan troglodytes miR-503 stem-loop
Gene family MIPF0000183; mir-503
Literature search

1 open access papers mention ptr-mir-503
(23 sentences)

Stem-loop
   u     a              u  g  gu     a 
5'  gcccu gcagcgggaacagu cu ca  gagcg u
    ||||| |||||||||||||| || ||  ||||| c
3'  uggga cgucgccuuuguua ga gu  cucgu g
   -     c              u  g  --     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 134416955-134417024 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-503
ptr-mir-424chrX: 134417241-134417337 [-]
ptr-mir-503chrX: 134416955-134417024 [-]
ptr-mir-450a-2chrX: 134411165-134411263 [-]
ptr-mir-450a-1chrX: 134410998-134411087 [-]
ptr-mir-450bchrX: 134410842-134410918 [-]
Database links

Mature sequence ptr-miR-503

Accession MIMAT0008176
Sequence

6 - 

uagcagcgggaacaguucugcag

 - 28

Get sequence
Evidence by similarity; MI0003188
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).