Stem-loop sequence ptr-mir-498

AccessionMI0008693 (change log)
DescriptionPan troglodytes miR-498 stem-loop
Gene family MIPF0000463; mir-498
Stem-loop
   acc  c       -aag  aag            -         -a     c       uaua 
5'    cu ccuuggg    ug   cucaggcuguga uuucaagcc  ggggg guuuuuc    a
      || |||||||    ||   |||||||||||| |||||||||  ||||| |||||||    c
3'    ga ggaaucu    ac   gaguuugacacu gaaguucgg  ccucc cgaaaag    u
   -uu  a       gcua  -ga            c         ga     a       uagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56022328-56022451 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-498
ptr-mir-1323chr19: 56020103-56020174 [+]
ptr-mir-498chr19: 56022328-56022451 [+]
ptr-mir-520echr19: 56023852-56023937 [+]
ptr-mir-515-1chr19: 56027150-56027231 [+]
ptr-mir-519echr19: 56028091-56028176 [+]
ptr-mir-520fchr19: 56030298-56030383 [+]
Database links

Mature sequence ptr-miR-498

Accession MIMAT0008171
Sequence

34 - 

uuucaagccagggggcguuuuuc

 - 56

Get sequence
Evidence by similarity; MI0003142
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).