Stem-loop sequence ptr-mir-496

AccessionMI0008692 (change log)
DescriptionPan troglodytes miR-496 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   -     -----uca     u    u        u     gu         uua 
5'  ccaag        gguac cgaa ggagguug ccaug  guguucauu   u
    |||||        ||||| |||| |||||||| |||||  |||||||||    
3'  gguuc        ucaug gcuu ccucuaac gguac  uaugaguag   u
   g     uucuuaac     -    u        c     au         uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86308822-86308922 [+]
sense
ENSPTRT00000054279 ; ptr-mir-496-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-496
ptr-mir-487achr14: 86300680-86300758 [+]
ptr-mir-382chr14: 86302540-86302614 [+]
ptr-mir-134chr14: 86302921-86302992 [+]
ptr-mir-668chr14: 86303493-86303557 [+]
ptr-mir-485chr14: 86303654-86303725 [+]
ptr-mir-453chr14: 86304425-86304503 [+]
ptr-mir-154chr14: 86308003-86308086 [+]
ptr-mir-496chr14: 86308822-86308922 [+]
ptr-mir-377chr14: 86310299-86310366 [+]
ptr-mir-409chr14: 86313550-86313627 [+]
ptr-mir-412chr14: 86313697-86313786 [+]
ptr-mir-369chr14: 86313848-86313916 [+]
ptr-mir-410chr14: 86314162-86314240 [+]
ptr-mir-656chr14: 86314977-86315053 [+]
Database links

Mature sequence ptr-miR-496

Accession MIMAT0008170
Sequence

55 - 

ugaguauuacauggccaaucuc

 - 76

Get sequence
Evidence by similarity; MI0003136
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).