Stem-loop sequence ptr-mir-484

AccessionMI0008680 (change log)
DescriptionPan troglodytes miR-484 stem-loop
Gene family MIPF0000219; mir-484
Stem-loop
   -   ----uc      cuca   c       au   -c    a 
5'  gcc      gucagg    guc ccucccg  aaa  cccu a
    |||      ||||||    ||| |||||||  |||  ||||  
3'  cgg      cggucc    cag ggggggc  uuu  ggga a
   g   uuuuuu      ----   u       cc   ca    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr16: 15864338-15864415 [+]
sense
ENSPTRT00000054509 ; ptr-mir-484-201; exon 1
Database links

Mature sequence ptr-miR-484

Accession MIMAT0008158
Sequence

7 - 

ucaggcucaguccccucccgau

 - 28

Get sequence
Evidence by similarity; MI0002468
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).