Stem-loop sequence ptr-mir-455

AccessionMI0008679 (change log)
DescriptionPan troglodytes miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   -----cccu   -g     -----          u      a   c   gaa 
5'          ggc  ugagg     guaugugccu uggacu cau gug   g
            |||  |||||     |||||||||| |||||| ||| |||    
3'          ccg  acucc     cauauacggg accuga gua cac   c
   cuacuguau   ga     guuca          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 92164401-92164495 [+]
sense
ENSPTRT00000054419 ; ptr-mir-455-201; exon 1
ENSPTRT00000039353 ; COL27A1-201; intron 7
Database links

Mature sequence ptr-miR-455

Accession MIMAT0008157
Sequence

53 - 

gcaguccaugggcauauacac

 - 73

Get sequence
Evidence by similarity; MI0003513
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).