Stem-loop sequence ptr-mir-454

AccessionMI0008678 (change log)
DescriptionPan troglodytes miR-454 stem-loop
Gene family MIPF0000174; mir-454
Literature search

1 open access papers mention ptr-mir-454
(8 sentences)

Stem-loop
   u       ----  --a     uc            ---         ----   --u     g 
5'  cuguuua    uc   ccaga  cuagaacccuau   caauauugu    cuc   gcugu u
    |||||||    ||   |||||  ||||||||||||   |||||||||    |||   |||||  
3'  gacgggu    ag   gguuu  gguuuugggaua   guuauaacg    gag   ugaua a
   -       aaca  aaa     gu            uuc         ugau   ucu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 58441228-58441341 [-]
sense
ENSPTRT00000017352 ; SKA2-201; intron 1
ENSPTRT00000060722 ; ptr-mir-454-201; exon 1
Database links

Mature sequence ptr-miR-454

Accession MIMAT0008156
Sequence

64 - 

uagugcaauauugcuuauagggu

 - 86

Get sequence
Evidence by similarity; MI0003820
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).