Stem-loop sequence ptr-mir-452

AccessionMI0008676 (change log)
DescriptionPan troglodytes miR-452 stem-loop
Gene family MIPF0000287; mir-452
Stem-loop
   gcu          aac g        g  a        uuug 
5'    aagcacuuac   u uuugcaga ga acugagac    u
      ||||||||||   | |||||||| || ||||||||    a
3'    uucgugaaug   a aaacgucu cu ugacucug    a
   -gu          --a g        a  c        uauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 151682943-151683026 [-]
sense
ENSPTRT00000054399 ; ptr-mir-452-201; exon 1
ENSPTRT00000041753 ; GABRE-201; intron 3
KV421455.1: 862908-862991 [+]
sense
ENSPTRT00000054399 ; ptr-mir-452-201; exon 1
ENSPTRT00000041753 ; GABRE-201; intron 3
Clustered miRNAs
< 10kb from ptr-mir-452
ptr-mir-452chrX: 151682943-151683026 [-]
ptr-mir-224chrX: 151681892-151681972 [-]
Database links

Mature sequence ptr-miR-452

Accession MIMAT0008154
Sequence

14 - 

aacuguuugcagaggaaacuga

 - 35

Get sequence
Evidence by similarity; MI0001733
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).