Stem-loop sequence ptr-mir-450a-2

AccessionMI0008673 (change log)
DescriptionPan troglodytes miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Stem-loop
   ccaaagaaa     u       uuu     u               aa 
5'          gaugc aaacuau   ugcga guguuccuaauaugu  u
            ||||| |||||||   ||||| |||||||||||||||  a
3'          cuaug uuugaua   acguu uacagggguuaugua  u
   guauaauaa     u       cuu     u               aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 134411165-134411263 [-]
sense
ENSPTRT00000054396 ; ptr-mir-450a-2-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-450a-2
ptr-mir-424chrX: 134417241-134417337 [-]
ptr-mir-503chrX: 134416955-134417024 [-]
ptr-mir-450a-2chrX: 134411165-134411263 [-]
ptr-mir-450a-1chrX: 134410998-134411087 [-]
ptr-mir-450bchrX: 134410842-134410918 [-]
Database links

Mature sequence ptr-miR-450a

Accession MIMAT0008151
Sequence

23 - 

uuuugcgauguguuccuaauau

 - 44

Get sequence
Evidence by similarity; MI0003187
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).