Stem-loop sequence ptr-mir-424

AccessionMI0008664 (change log)
DescriptionPan troglodytes miR-424 stem-loop
Gene family MIPF0000164; mir-322
Literature search

1 open access papers mention ptr-mir-424
(1 sentences)

Stem-loop
   --------------------       a  c      aa             g   u 
5'                     cgagggg ua agcagc  uucauguuuugaa ugu c
                       ||||||| || ||||||  ||||||||||||| ||| u
3'                     gcucccc au ucgucg  gagugcaaaacuu gua a
   ggguggaagauggaaggggu       c  a      cg             g   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 134417241-134417337 [-]
sense
ENSPTRT00000054313 ; ptr-mir-424-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-424
ptr-mir-424chrX: 134417241-134417337 [-]
ptr-mir-503chrX: 134416955-134417024 [-]
ptr-mir-450a-2chrX: 134411165-134411263 [-]
ptr-mir-450a-1chrX: 134410998-134411087 [-]
ptr-mir-450bchrX: 134410842-134410918 [-]
Database links

Mature sequence ptr-miR-424

Accession MIMAT0008143
Sequence

11 - 

cagcagcaauucauguuuugaa

 - 32

Get sequence
Evidence by similarity; MI0001446
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).