Stem-loop sequence ptr-mir-423

AccessionMI0008663 (change log)
DescriptionPan troglodytes miR-423 stem-loop
Gene family MIPF0000329; mir-423
Stem-loop
   ----auaa       u            -ag   g    a     cua 
5'         aggaagu aggcugaggggc   aga cgag cuuuu   u
           ||||||| ||||||||||||   ||| |||| |||||   u
3'         uccuucg ucugacuccccg   ucu gcuc gaaaa   u
   gcgcccca       u            gag   g    -     ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 26983568-26983660 [-]
sense
ENSPTRT00000016522 ; CCDC55-203; intron 1
ENSPTRT00000054292 ; ptr-mir-423-201; exon 1
Database links

Mature sequence ptr-miR-423

Accession MIMAT0008142
Sequence

53 - 

agcucggucugaggccccucagu

 - 75

Get sequence
Evidence by similarity; MI0001445
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).