Stem-loop sequence ptr-mir-383

AccessionMI0008656 (change log)
DescriptionPan troglodytes miR-383 stem-loop
Gene family MIPF0000137; mir-383
Literature search

1 open access papers mention ptr-mir-383
(5 sentences)

Stem-loop
   cuccuca      aa    a        uug   gga 
5'        gaucag  ggug uuguggcu   ggu   u
          ||||||  |||| ||||||||   |||    
3'        cugguc  ucac gacaccga   cua   a
   agaaaga      cg    -        ---   auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr8: 13935372-13935443 [-]
sense
ENSPTRT00000037070 ; SGCZ-201; intron 1
ENSPTRT00000054493 ; ptr-mir-383-201; exon 1
Database links

Mature sequence ptr-miR-383

Accession MIMAT0008135
Sequence

7 - 

agaucagaaggugauuguggcu

 - 28

Get sequence
Evidence by similarity; MI0000791
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).