Stem-loop sequence ptr-mir-374a

AccessionMI0008643 (change log)
DescriptionPan troglodytes miR-374a stem-loop
Gene family MIPF0000288; mir-374
Stem-loop
   u    c   c            c           u 
5'  acau ggc auuauaauacaa cugauaagugu a
    |||| ||| |||||||||||| |||||||||||  
3'  ugug cug uaauguuauguu gacuauucacg u
   -    u   u            a           a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 73670202-73670272 [-]
sense
ENSPTRT00000054367 ; ptr-mir-374a-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-374a
ptr-mir-374achrX: 73670202-73670272 [-]
ptr-mir-545chrX: 73670020-73670124 [-]
Database links

Mature sequence ptr-miR-374a

Accession MIMAT0008123
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Evidence by similarity; MI0000782
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).