Stem-loop sequence ptr-mir-365-1

AccessionMI0008636 (change log)
DescriptionPan troglodytes miR-365-1 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   cc      aa        ac           ----   -   uuu 
5'   gcaggg  aaugaggg  uuuugggggca    gau gug   c
     ||||||  ||||||||  |||||||||||    ||| |||   c
3'   cguucu  uuauuccu  aaaauccccgu    cua cac   a
   -a      cg        -a           aaua   u   cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr16: 14756979-14757064 [+]
sense
ENSPTRT00000054327 ; ptr-mir-365-1-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-365-1
ptr-mir-193bchr16: 14751623-14751704 [+]
ptr-mir-365-1chr16: 14756979-14757064 [+]
Database links

Mature sequence ptr-miR-365

Accession MIMAT0008117
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Evidence by similarity; MI0000769
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).