Stem-loop sequence ptr-mir-34c

AccessionMI0008633 (change log)
DescriptionPan troglodytes miR-34c stem-loop
Gene family MIPF0000039; mir-34
Literature search

1 open access papers mention ptr-mir-34c
(18 sentences)

Stem-loop
   -    ag     a   a    a     c      c  a 
5'  gucu  uuacu ggc gugu guuag ugauug ua u
    ||||  ||||| ||| |||| ||||| |||||| ||  
3'  uaga  aaugg ccg caca caauc acuaac au a
   u    aa     a   g    c     -      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 111895735-111895810 [+]
sense
ENSPTRT00000054525 ; ptr-mir-34c-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-34c
ptr-mir-34bchr11: 111895234-111895316 [+]
ptr-mir-34cchr11: 111895735-111895810 [+]
Database links

Mature sequence ptr-miR-34c

Accession MIMAT0008114
Sequence

45 - 

aaucacuaaccacacggccagg

 - 66

Get sequence
Evidence by similarity; MI0000743
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).