Stem-loop sequence ptr-mir-34b

AccessionMI0008632 (change log)
DescriptionPan troglodytes miR-34b stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   -    cg    -gua       uca    c        -  g 
5'  ugcu  guuu    ggcagug   uuag ugauugua cu u
    ||||  ||||    |||||||   |||| |||||||| || g
3'  acgg  caaa    ccgucac   aauc acuaacau gg g
   c    aa    acua       cuc    -        u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 111895234-111895316 [+]
sense
ENSPTRT00000054342 ; ptr-mir-34b-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-34b
ptr-mir-34bchr11: 111895234-111895316 [+]
ptr-mir-34cchr11: 111895735-111895810 [+]
Database links

Mature sequence ptr-miR-34b

Accession MIMAT0008113
Sequence

49 - 

caaucacuaacuccacugccau

 - 70

Get sequence
Evidence by similarity; MI0000742
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).