Stem-loop sequence ptr-mir-33b

AccessionMI0008627 (change log)
DescriptionPan troglodytes miR-33b stem-loop
Gene family MIPF0000070; mir-33
Stem-loop
   ---------c    -   c   c  -          uu         g   g 
5'           gggc ggc ccg gg ugcauugcug  gcauugcac ugu u
             |||| ||| ||| || ||||||||||  ||||||||| ||| g
3'           cccg ccg ggc cc acgugacggc  cgugacgug gcg a
   caccacgguc    g   a   -  g          uc         g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 39817932-39818026 [+]
sense
ENSPTRT00000054665 ; ptr-mir-33b-201; exon 1
Database links

Mature sequence ptr-miR-33b

Accession MIMAT0008108
Sequence

15 - 

gugcauugcuguugcauugc

 - 34

Get sequence
Evidence by similarity; MI0003646
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).