|
miRBase |
|
miRBase has moved to http://www.mirbase.org/ - please update your links.
Stem-loop sequence MI0008605 |
||||||
| Accession | MI0008605 | |||||
| ID | ptr-mir-30c-1 | |||||
| Description | Pan troglodytes miR-30c-1 stem-loop | |||||
| Stem-loop |
- cu ugu u u aca ---g a ccaug guag g guaaaca ccu cucucagcu ug g ||||| |||| | ||||||| ||| ||||||||| || gguac cguc c cauuugu ggg gagggucgg ac c a -- uuc u u --a ugga u |
|||||
| Genome context |
|
|||||
| Clustered miRNAs |
|
|||||
| Gene family |
MIPF0000005; mir-30 |
|||||
Mature sequence MIMAT0002614 |
|
| Accession | MIMAT0002614 |
| ID | ptr-miR-30c |
| Sequence |
16 - uguaaacauccuacacucucagc - 38 |
| Evidence | by similarity; MI0000736 |
| Predicted targets |
|
References |
|
| 1 |
"Computational identification of novel microRNA homologs in the chimpanzee genome"
Comput Biol Chem. 33:62-70(2009).
|