Stem-loop sequence ptr-mir-301a

AccessionMI0008597 (change log)
DescriptionPan troglodytes miR-301a stem-loop
Gene family MIPF0000034; mir-130
Literature search

1 open access papers mention ptr-mir-301a
(1 sentences)

Stem-loop
   a     aa  a     c    ---u          ----a       
5'  cugcu  cg augcu ugac    uuauugcacu     cuguac 
    |||||  || ||||| ||||    ||||||||||     ||||| u
3'  gacga  gu uacga acug    gauaacguga     gacauu 
   -     aa  c     a    uuau          cgauc       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 58454719-58454803 [-]
sense
ENSPTRT00000017352 ; SKA2-201; intron 1
ENSPTRT00000054254 ; ptr-mir-301a-201; exon 1
Database links

Mature sequence ptr-miR-301a

Accession MIMAT0008084
Sequence

51 - 

cagugcaauaguauugucaaagc

 - 73

Get sequence
Evidence by similarity; MI0000745
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).