Stem-loop sequence ptr-mir-29c

AccessionMI0008595 (change log)
DescriptionPan troglodytes miR-29c stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   au        -  ggc           ucc       ---     u 
5'   cucuuaca ca   ugaccgauuuc   ugguguu   cagag c
     |||||||| ||   |||||||||||   |||||||   ||||| u
3'   ggggaugu gu   auuggcuaaag   accacga   guuuu g
   -g        a  ---           uuu       ucu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr1: 186692183-186692269 [-]
sense
ENSPTRT00000054462 ; ptr-mir-29c-201; exon 1
antisense
ENSPTRT00000003526 ; CR1-201; intron 39
Clustered miRNAs
< 10kb from ptr-mir-29c
ptr-mir-29b-2chr1: 186692773-186692853 [-]
ptr-mir-29cchr1: 186692183-186692269 [-]
Database links

Mature sequence ptr-miR-29c

Accession MIMAT0008082
Sequence

54 - 

uagcaccauuugaaaucgguua

 - 75

Get sequence
Evidence by similarity; MI0000735
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).