Stem-loop sequence ptr-mir-297

AccessionMI0008593 (change log)
DescriptionPan troglodytes miR-297 stem-loop
Gene family MIPF0000204; mir-297
Stem-loop
   ugu       u       ugc           u 
5'    auguaug gugcaug   auguaugugug a
      ||||||| |||||||   |||||||||||  
3'    uauauac cauguau   uguauacauac u
   --c       u       -ua           a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr4: 113868090-113868154 [-]
intergenic
Database links

Mature sequence ptr-miR-297

Accession MIMAT0008080
Sequence

4 - 

auguaugugugcaugugcaug

 - 24

Get sequence
Evidence by similarity; MI0005775
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).