Stem-loop sequence ptr-mir-219-2

AccessionMI0008585 (change log)
DescriptionPan troglodytes miR-219-2 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   acuca       c     u   u     aa           uac a  c 
5'      ggggcuu gccac gau gucca  cgcaauucuug   g gu u
        ||||||| ||||| ||| |||||  |||||||||||   | || g
3'      ccucgag cggug cua caggu  guguuaagagc   c cg c
   ---gg       u     u   -     cg           caa -  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 106531883-106531978 [-]
sense
ENSPTRT00000054286 ; ptr-mir-219-2-201; exon 1
KV421084.1: 376673-376768 [-]
sense
ENSPTRT00000054286 ; ptr-mir-219-2-201; exon 1
Database links

Mature sequence ptr-miR-219-5p

Accession MIMAT0009193
Sequence

19 - 

ugauuguccaaacgcaauucu

 - 39

Get sequence
Evidence by similarity; MI0000740
Predicted targets

Mature sequence ptr-miR-219-2-3p

Accession MIMAT0009194
Sequence

62 - 

agaauuguggcuggacaucugu

 - 83

Get sequence
Evidence by similarity; MI0000740
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).