Stem-loop sequence ptr-mir-202

AccessionMI0008574 (change log)
DescriptionPan troglodytes miR-202 stem-loop
Gene family MIPF0000121; mir-202
Stem-loop
   cuccuca   cc     -       u           -a           g   au 
5'        gag  gcccg ccguucc uuuuccuaugc  uauacuucuuu agg  c
          |||  ||||| ||||||| |||||||||||  ||||||||||| |||   
3'        cuc  ugggc ggcgggg aaaaggguacg  auauggagaaa ucc  u
   -cgaccc   -c     u       c           gg           -   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr10: 135422705-135422813 [-]
intergenic
Database links

Mature sequence ptr-miR-202

Accession MIMAT0008064
Sequence

64 - 

agagguauagggcaugggaa

 - 83

Get sequence
Evidence by similarity; MI0003130
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).