Stem-loop sequence ptr-mir-199b

AccessionMI0008572 (change log)
DescriptionPan troglodytes miR-199b stem-loop
Gene family MIPF0000040; mir-199
Literature search

1 open access papers mention ptr-mir-199b
(1 sentences)

Stem-loop
   cca    -acacc    cu  -     c       u       u    u  ----  a 
5'    gagg      ucca  cc gucua ccagugu uagacua cugu ca    gg c
      ||||      ||||  || ||||| ||||||| ||||||| |||| ||    ||  
3'    cucc      gggu  gg cggau gguuaca gucugau gaca gu    cc u
   --g    cagauu    cg  u     u       c       -    u  uaaa  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 106385739-106385847 [-]
sense
ENSPTRT00000054506 ; ptr-mir-199b-201; exon 1
antisense
ENSPTRT00000067307 ; DNM1-201; intron 15
ENSPTRT00000046473 ; DNM1-202; intron 15
KV421084.1: 210110-210218 [-]
sense
ENSPTRT00000054506 ; ptr-mir-199b-201; exon 1
antisense
ENSPTRT00000067307 ; DNM1-201; intron 15
ENSPTRT00000046473 ; DNM1-202; intron 15
Clustered miRNAs
< 10kb from ptr-mir-199b
ptr-mir-3154chr9: 106385956-106386064 [-]
ptr-mir-199bchr9: 106385739-106385847 [-]
Database links

Mature sequence ptr-miR-199b

Accession MIMAT0008062
Sequence

65 - 

acaguagucugcacauugguua

 - 86

Get sequence
Evidence by similarity; MI0000282
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).