Stem-loop sequence ptr-mir-199a-1

AccessionMI0008571 (change log)
DescriptionPan troglodytes miR-199a-1 stem-loop
Gene family MIPF0000040; mir-199
Literature search

2 open access papers mention ptr-mir-199a-1
(5 sentences)

Stem-loop
   g  aac       u        c   u  ---g     
5'  cc   ccagugu cagacuac ugu ca    gagg 
    ||   ||||||| |||||||| ||| ||    ||| c
3'  gg   gguuaca gucugaug aca gu    cucu 
   -  auu       c        -   u  guaa     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 11396978-11397047 [-]
sense
ENSPTRT00000054401 ; ptr-mir-199a-1-201; exon 1
antisense
ENSPTRT00000065036 ; DNM2-201; intron 15
Database links

Mature sequence ptr-miR-199a-3p

Accession MIMAT0009192
Sequence

47 - 

acaguagucugcacauugguua

 - 68

Get sequence
Evidence by similarity; MI0000242
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).