Stem-loop sequence ptr-mir-195

AccessionMI0008568 (change log)
DescriptionPan troglodytes miR-195 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   a   u     g  cu          -a          caggga 
5'  gcu cccug cu  agcagcacag  aauauuggca      a
    ||| ||||| ||  ||||||||||  ||||||||||       
3'  ugg gggac ga  ucgucguguc  uuauaaccgu      g
   -   u     g  cc          gg          cugagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr17: 7272655-7272740 [-]
sense
ENSPTRT00000054310 ; ptr-mir-195-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-195
ptr-mir-497chr17: 7272971-7273039 [-]
ptr-mir-195chr17: 7272655-7272740 [-]
Database links

Mature sequence ptr-miR-195

Accession MIMAT0008060
Sequence

15 - 

uagcagcacagaaauauuggc

 - 35

Get sequence
Evidence by similarity; MI0000489
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).