Stem-loop sequence ptr-mir-18b

AccessionMI0008562 (change log)
DescriptionPan troglodytes miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   uguguu    u    c   u     ua  --g     
5'       aagg gcau uag gcagu  gu   aagc 
         |||| |||| ||| |||||  ||   ||| a
3'       uucc cgua auc cguca  ua   uucg 
   -cgguc    c    a   c     uc  aga     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 134038262-134038331 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-18b
ptr-mir-106achrX: 134038418-134038498 [-]
ptr-mir-18bchrX: 134038262-134038331 [-]
ptr-mir-20bchrX: 134038030-134038097 [-]
ptr-mir-19b-2chrX: 134037891-134037987 [-]
ptr-mir-92-2chrX: 134037758-134037832 [-]
Database links

Mature sequence ptr-miR-18b

Accession MIMAT0008054
Sequence

6 - 

uaaggugcaucuagugcaguuag

 - 28

Get sequence
Evidence by similarity; MI0001518
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).