Stem-loop sequence ptr-mir-181b-2

AccessionMI0008556 (change log)
DescriptionPan troglodytes miR-181b-2 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   -uga   -     cucaa         cu           u  gu 
5'     ugg cugca     cauucauug  gucgguggguu ga  c
       ||| |||||     |||||||||  ||||||||||| ||  u
3'     acc ggcgu     guaaguagc  uagucacucaa cu  g
   acaa   a     caaac         --           -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 102768161-102768248 [+]
sense
ENSPTRT00000061357 ; ptr-mir-181b-2-201; exon 1
antisense
ENSPTRT00000039503 ; NR6A1-202; intron 2
Clustered miRNAs
< 10kb from ptr-mir-181b-2
ptr-mir-181a-2chr9: 102766897-102767006 [+]
ptr-mir-181b-2chr9: 102768161-102768248 [+]
Database links

Mature sequence ptr-miR-181b

Accession MIMAT0002625
Sequence

15 - 

aacauucauugcugucggugggu

 - 37

Get sequence
Evidence by similarity; MI0000683
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).