Stem-loop sequence ptr-mir-16-2

AccessionMI0008555 (change log)
DescriptionPan troglodytes miR-16-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   u  -    cu         ua        c  ag   aau 
5'  uc cacu  agcagcacg  aauauugg gu  uga   a
    || ||||  |||||||||  |||||||| ||  |||    
3'  ag guga  ucgucgugu  uuauaacc ca  auu   u
   c  u    uu         ca        a  -a   gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr3: 164010702-164010781 [+]
sense
ENSPTRT00000049486 ; SMC4-201; intron 5
Clustered miRNAs
< 10kb from ptr-mir-16-2
ptr-mir-15bchr3: 164010544-164010641 [+]
ptr-mir-16-2chr3: 164010702-164010781 [+]
Database links

Mature sequence ptr-miR-16

Accession MIMAT0002655
Sequence

9 - 

uagcagcacguaaauauuggcg

 - 30

Get sequence
Evidence by similarity; MI0000115
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).