Stem-loop sequence ptr-mir-146b

AccessionMI0008545 (change log)
DescriptionPan troglodytes miR-146b stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   - u      g        au        cu  ga  u 
5'  c ggcacu agaacuga  uccauagg  gu  gc c
    | |||||| ||||||||  ||||||||  ||  ||  
3'  g ccgugg ucuugacu  aggugucc  ua  cg u
   g c      -        -c        cg  -a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr10: 103890510-103890581 [+]
sense
ENSPTRT00000054307 ; ptr-mir-146b-201; exon 1
Database links

Mature sequence ptr-miR-146b

Accession MIMAT0008039
Sequence

8 - 

ugagaacugaauuccauaggcu

 - 29

Get sequence
Evidence by similarity; MI0003129
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).