Stem-loop sequence ptr-mir-146a

AccessionMI0008544 (change log)
DescriptionPan troglodytes miR-146a stem-loop
Gene family MIPF0000103; mir-146
Stem-loop
   -     -----u      u     uu            c        g  uc 
5'  cgaug      guaucc cagcu  gagaacugaauu cauggguu ug  a
    |||||      |||||| |||||  |||||||||||| |||||||| ||  g
3'  gcuac      uauagg gucga  uucuugacuuaa guguccag ac  u
   u     ugucuc      -     -c            a        -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr5: 160823646-160823743 [+]
intergenic
Database links

Mature sequence ptr-miR-146a

Accession MIMAT0008038
Sequence

20 - 

ugagaacugaauuccauggguu

 - 41

Get sequence
Evidence by similarity; MI0000477
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).