Stem-loop sequence ptr-mir-1302-8

AccessionMI0008523 (change log)
DescriptionPan troglodytes miR-1302-8 stem-loop
Gene family MIPF0000456; mir-1302
Literature search

1 open access papers mention ptr-mir-1302-8
(2 sentences)

Stem-loop
   -        a   u        u  a       --       -c     u     a  a  ugc 
5'  cccauuua acu gaauuuca au aacaccg  uaauuuu  agcau agugu uc ca   a
    |||||||| ||| |||||||| || |||||||  |||||||  ||||| ||||| || ||   g
3'  ggguagau uga cuuaaagu ua uuguggu  auuaaaa  ucgua ucaua ag gu   u
   c        g   c        c  g       gg       aa     u     c  g  uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr9: 75086784-75086910 [-]
sense
ENSPTRT00000068555 ; ptr-mir-1302-8-201; exon 1
antisense
ENSPTRT00000039133 ; CCDC180-201; intron 28
Database links

Mature sequence ptr-miR-1302

Accession MIMAT0008021
Sequence

66 - 

uugggacauacuuaugcuaaa

 - 86

Get sequence
Evidence by similarity; MI0006369
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).