Stem-loop sequence ptr-mir-129-2

AccessionMI0008494 (change log)
DescriptionPan troglodytes miR-129-2 stem-loop
Gene family MIPF0000073; mir-129
Stem-loop
   -             -       c   cu      ---     acau 
5'  gcccuucgcgaau cuuuuug ggu  gggcuu   gcugu    a
    ||||||||||||| ||||||| |||  ||||||   |||||     
3'  cgggaggcguuua gaaaaac cca  cccgaa   cgaua    a
   g             c       c   uu      ggc     acuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr11: 43765047-43765135 [+]
sense
ENSPTRT00000054459 ; ptr-mir-129-2-201; exon 1
Database links

Mature sequence ptr-miR-129

Accession MIMAT0008010
Sequence

14 - 

cuuuuugcggucugggcuugc

 - 34

Get sequence
Evidence by similarity; MI0000473
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).