Stem-loop sequence ptr-mir-1283a

AccessionMI0008484 (change log)
Previous IDsptr-mir-1283
DescriptionPan troglodytes miR-1283 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   ---               ac     a           g  g c 
5'    ucaggcugugacucu  aaagg aagcgcuuucu uu u a
      |||||||||||||||  ||||| ||||||||||| || | g
3'    aguuuggcauuggga  uuucc uucgcgaaaga aa a a
   aag               gu     c           g  g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr19: 56036646-56036731 [+]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-1283a
ptr-mir-515-1chr19: 56027150-56027231 [+]
ptr-mir-519echr19: 56028091-56028176 [+]
ptr-mir-520fchr19: 56030298-56030383 [+]
ptr-mir-515-2chr19: 56033165-56033246 [+]
ptr-mir-519cchr19: 56034635-56034720 [+]
ptr-mir-1283achr19: 56036646-56036731 [+]
ptr-mir-520achr19: 56039028-56039111 [+]
ptr-mir-526bchr19: 56042520-56042601 [+]
ptr-mir-519bchr19: 56043334-56043413 [+]
ptr-mir-525chr19: 56045667-56045750 [+]
ptr-mir-523chr19: 56046532-56046610 [+]
Database links

Mature sequence ptr-miR-1283a

Accession MIMAT0008002
Previous IDsptr-miR-1283
Sequence

13 - 

ucuacaaaggaaagcgcuuucu

 - 34

Get sequence
Evidence by similarity; MI0003832
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).