Stem-loop sequence ptr-mir-1282-2

AccessionMI0008483 (change log)
DescriptionPan troglodytes miR-1282-2 stem-loop
Gene family MIPF0000587; mir-1282
Stem-loop
   ccuucu   cg          uc       -gc   aug   -  -   ag   c 
5'       ucu  uuugccuuuu  ugcuucu   ugc   auc uc cug  ucc u
         |||  ||||||||||  |||||||   |||   ||| || |||  |||  
3'       aga  aaacgggaga  auggagg   acg   ugg ag gau  ggg g
   -----a   -a          cu       auc   gga   u  a   --   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr7: 99179076-99179176 [-]
sense
ENSPTRT00000035945 ; SLC25A13-201; intron 1
Database links

Mature sequence ptr-miR-1282

Accession MIMAT0008001
Sequence

9 - 

ucguuugccuuuuucugcuu

 - 28

Get sequence
Evidence by similarity; MI0006429
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).