Stem-loop sequence ptr-mir-1282-1

AccessionMI0008481 (change log)
DescriptionPan troglodytes miR-1282-1 stem-loop
Gene family MIPF0000587; mir-1282
Stem-loop
   ccuucu   cg          uc       ----   g   g     cgag   c 
5'       ucu  uuugccuuuu  ugcuucu    gcu cau aucuc    ucc u
         |||  ||||||||||  |||||||    ||| ||| |||||    |||  
3'       agg  aaacgggaga  auggagg    cgg gua uagag    ggg g
   ------   aa          cc       guca   g   g     --au   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr15: 24380390-24380489 [-]
sense
ENSPTRT00000068213 ; ptr-mir-1282-1-201; exon 1
antisense
ENSPTRT00000012926 ; ptr-mir-1282-1-201; 3'UTR (exon 3)
Database links

Mature sequence ptr-miR-1282

Accession MIMAT0008001
Sequence

9 - 

ucguuugccuuuuucugcuu

 - 28

Get sequence
Evidence by similarity; MI0006429
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).